Assignment 3
Who are the ancestors of the dinosaurs?
Science 1994 Nov 18;266(5188):1229-1232
DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah. This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b. These sequences differ from all other cytochrome b sequences investigated, including those in the GenBank and European Molecular Biology Laboratory databases.
DNA isolated from these bone fragments and the resulting gene sequences demonstrate that small fragments of DNA may survive in bone for millions of years. The authors conclude that the DNA sequence,
cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaac
aaagcataatattccacccattgagtccattcctatcctgattcttagtccccgaacctt
ttacactcacatg
,appears to be from a dinosaur that lived 80 million years ago.
Show us step by step of how to do phylogenetic analysis with cytochrome b sequences. Then, what is your conclusion about the structure of the tree and the position of the dinosaur sequence that might come close to these following species? Use these following species;
o Human
o Dog
o Rabbit
o rhinoceros
o dugong
o mouse
o whale
o bovine
o sicklebill
o chicken
o magpie
o frog
Step 1. State the Hypothesis.
Ho: The nucleotide sequences from the 80-million-year-old bone fragments were more closer to the avians than the frog and mammals sequences.
H1: The nucleotide sequences from the 80-million-year-old bone fragments were not closer to the avians than the frog and mammals sequences.
Step 2 . Retrieve the sequence of cytochrome b gene (CYTB) from NCBI DNA databases
1. Go to NCBI website http://www.ncbi.nlm.nih.gov/.
- In the following steps, I only show step by step how to retrieve CYTB sequence of human. For the rest of other species, I will summarize the outcome of retrieved DNA and show it in the table 1.
- Search NCBI nucleotide using ”cytochrome b AND Homo sapiens”.
- click ” CYTB”.
- The screenshot will appear.
- Then choose “reference sequence details” and click it.
- We will find ”NCBI Reference Sequences (RefSeq)”. The following sections contain reference sequences that belong to a specific genome build.
- Click on YP_003024038.1 cytochrome b [Homo sapiens].
- Then we get this screenshot.
- To find reference sequence for CYTB, Click on “DBSOURCE REFSEQ: accession NC_012920.1” the screenshot will show;
- Find the name of cytochrome b gene.
: /gene=”CYTB” and
:CDS (coding sequence) and the position of base sequence.
- Put the CDS (Coding Sequence): 14747..15887 in the Change Region Shown
- Selected Region from begin to end in which 14747 is the begin value and 15887 is the end value.
- Then click “UPdate View”.
- We will get NCBI Reference Sequence: NC_012920. REGION: 14747..15887 for CYTB
- To obtain FASTA format of CYTB, click FASTA format on th top menu of the page.
- The FASTA format of CYTB will be obtained
- Copy CYTB sequence (FASTA format) into Notepad.
- To retrieve the sequence for cytochrome b (CYTB) for the rest of interested animal species from the NCBI database, the processes to obtain CYTB sequences are the same as human.
- The output of retrieved CYTB are as follows; (Table 1.)
- FASTA format for cytochome b sequence of 13 species are put together in Notepad in one file “ALL species-FASTA.txt ”
Step 3 . DNA Sequence Alignment
1. Download BioEdit program from website http://www.mbio.ncsu.edu/BioEdit/bioedit.html
2. Install BioEdit program in the Desktop of computer C:\Documents and Settings\cha\Desktop.
3. Open BioEdit program
- Welcomimg’ s page of BioEdit
4. Open file “All species-FASTA.text” (Cytochome b sequence of all 13 species in FASTA format).
File—–> Open
5. The screenshot will appear.
5. Multiple sequence alignment using ClustalW multiple alignment.
Accesory Application—–>ClustalW multiple alignment
6. Click “ClustalW multiple alignment”.
-Set ClustalW alignment option as:
: Full Multiple Alignment
: Bootstrap NJ Tree Number of bootstraps: 1000
7. Click “Run ClustalW”.
8. To analyse the phylogenetic relationship, Parsimony method (character-based method) was used.
9.Click on “Run Application’.
10. One most Parsimonous tree was produced using DNA parsimony algorithm.
11. One most Parsimonous tree “outtree” was produced automatically.
To display phylogenetic relationship, TreeView programm was downloaded from http://taxonomy.zoology.gla.ac.uk/rod/treeview.html
- Open TreeView program then open ”outtree” file.
- Dinosuar had a longest branch implying the highest number of substitution of cytb gene.
12. Define outgroup.
- On the Tree menu choose “Define outgroup”.
Tree —->Define outgroup
- To root the tree with an outgroup
-On the Tree menu, click “Root with outgroup”.
13. Resulting Phylogenetic tree after setting L. bannaensis (frog) as an outgoup and root the tree with an outgroup.
Furthermore, I have used Clustalx to align multiple sequences, and Phylip program to reconstruct phylogetic relationship which analysed with parsimony method (dnapars). TreeView program was used to display the topology of tree. It was found that the resulting trees which produced by diffferent alignment programs (BioEdit vs. Clustalx) and phylogenetic analysis programs (BioEdit vs. Phylip) but used the same method of analysis(DNA parsimony) producing the same topology of tree.
Conclusion:
Based on the parsimony method (a character-based method) in phylogenetic anaysis, the nucleotide sequences from the 80-million-year-old bone fragments (Dinosuar) were closer to the avian sequences (birds and chicken), as compared with frog and mammals sequences. Magpie (Cissa chinensis) was the closest relative to dinosaur and formed a clade with birds and chicken, whereas all mammals formed another clade. It is noticed that the limited regions of the gene encoding cytochrome b of the 80-million-year-old bone fragments (133 bp ) that was too short for use in phylogenetic analysis.
ความเห็นล่าสุด